AMBER Archive (2009)

Subject: Re: [AMBER] The resonable way to create single strand DNA with NAB ?

From: David A. Case (case_at_biomaps.rutgers.edu)
Date: Mon May 11 2009 - 06:34:16 CDT

On Sun, May 10, 2009, Marek Malư wrote:
>
> I would like to create single strand DNA "CTCTCGCACCCATCTCTCTCCTTCT"
> (GEM91) using NAB program.

There is, presumably, no single correct struture for single-stranded DNA. It
is reasonable to create a duplex, then remove one of the strands, but this is
only a rough approximation.

The fd_helix() routine in NAB is appropriate, or you can create a variety of
DNA helices at http://w3dna.rutgers.edu/index.php/rebuild.

> m = link_na("1", seq, "dna.amber94.rlb", "dna", "35");

This creates a arbitrary structure; the torsion angles on the backbone are
unlikely to be reasonable. It is intended for constructing the covalent
structure only.

> m = bdna( "ctctcgcacccatctctctccttct" );

This should be fine, after removing the second strand.

> putpdb( "GEM91ds.pdb", m );

> In the case #1 there is used CYT, THY, GUA ... and in the case #2
> DC,DT,DG ...

The latter is consistent with the current (version 3) naming scheme in the
PDB.

...dac

_______________________________________________
AMBER mailing list
AMBER_at_ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber