AMBER Archive (2009)

Subject: [AMBER] The resonable way to create single strand DNA with NAB ?

From: Marek Malý (maly_at_sci.ujep.cz)
Date: Sun May 10 2009 - 12:12:09 CDT

Dear Amber users,

I would like to create single strand DNA "CTCTCGCACCCATCTCTCTCCTTCT"
(GEM91) using NAB program.

I have already tried 2 different ways how to do it and I have obtained 2
quite different structures (please see attached picture GEM91.png). I
would like to know
which of this two ways is more appropriate. Or if they are equivalent
since after some minimisation and simulation, differences
between these two structures will almost disappear ?

Way #1

I have used this NAB code:

---------------------------------------------------------
molecule m;
string seq;
seq = "CTCTCGCACCCATCTCTCTCCTTCT";
m = link_na("1", seq, "dna.amber94.rlb", "dna", "35");
putpdb( "GEM91.pdb", m );
---------------------------------------------------------
Please see the attached file GEM91.pdb .

Way #2

I have used this NAB code to generate GEM91 B-DNA duplex and
than I deleted the antisense strand from the GEM91ds.pdb file
(please see attached GEM91ds_ss.pdb )

---------------------------------------------
molecule m;
m = bdna( "ctctcgcacccatctctctccttct" );
putpdb( "GEM91ds.pdb", m );
--------------------------------------------

There are not only differences in structures but also in naming of
residuies.

In the case #1 there is used CYT, THY, GUA ... and in the case #2 DC,DT,DG
...
which could affect parametrisation ? So If I use way #2 could it be a
good idea
to rename DC -> CYT, DT -> THY ... since DC, DT , DG signalize residuies
in duplex ?

I have also additional question. How it is with UPPER-case versus
LOWER-case expressions
of nucleotide sequences ?

In Amber10 manual i found the information that regarding to function
link_na() UPPER-case is recommended (please see page 171),
but in the same manual (page 116) is the example how to create B-duplex
using function bdna(), where is the sequence expressed
in LOWER-case manner an I also verified that UPPER-case doesn't work here
at least for my DNA. So I am a little confused now.

Do I understand well that link_na() function requires UPPER-case and
bdna() function LOWER-case sequence expressions ?

Thank you very much in advance for your help !

     Best,

      Marek 

-- 
Tato zpráva byla vytvořena převratným poštovním klientem Opery:  
http://www.opera.com/mail/
  • application/octet-stream attachment: GEM91.pdb

_______________________________________________
AMBER mailing list
AMBER_at_ambermd.org
http://lists.ambermd.org/mailman/listinfo/amber